Experimental (see below)
+++ We are currently creating content for this site. In order to meet our own high quality standards, we still need some time.
Please visit this page again soon. Thank you for your interest! +++
Input:
Over 60 genomes > 300 GB from nine Diplacus species are published. We looked at one aspect of these genomes: the R2R3-MYB factor responsible for anthocyanin synthesis activation. A cross-comparison revealed that the protein structure of this factor is almost identical in all closely related species. This regulator is not active in yellow-flowering forms.
Excerpt from the protein sequence of R2R3-MYB2. What is
striking is the Ear Motif (MSE), which is either missing or present.
We asked ourselves whether there are STRs (short tandem repeats) that have a regulatory function in addition to the already mentioned ear motif (GAAATGAGT).
Two STRs are very easy to find. There was once a TATATA ... motif located at the rear end of the first intron. At the beginning of the second intron, there is a second TCTCTATA... motif. These motifs vary in length among the nine Diplacus taxa.
The forms with particularly long reads and the ear motif are all red-flowered; those with short reads are all yellow-flowered. Since there are no notable differences in the coding sequence other than the two STRs mentioned above, we took a closer look at these STRs in all closely related species. These STRs may be causally related to the activity of the factor and, thus, to the direct formation of anthocyanin in the epidermis of the flower petals.
A uniform picture is presented across all forms. see excel file on the right.
Image 1) Transcription machinery with subsequent splicing process. The spliceosomes are responsible for this (arrows).
Image 2) Single-stranded RNA tends to form hairpins. At the end of the intron, such a short hairpin is shown in the yellow-flowered form. This hairpin does not like to influence the protein (hypothesis).
Image 3) It looks completely different when the hairpin, which is twice as long, comes from the red-flowered form into the area of influence of the protein. The spliceosome becomes active and separates the intron region from the exon region. Therefore, the RNA translates into an active protein, which might be impossible in the first case.
A yellow-flowering Diplacus plant can lengthen the hairpin through an autonomous process due to environmental pressure, thus bringing about the red-flowering form from a yellow-flowering form. All other requirements have already been met because this process's complete set of genes already exists. All that is needed is targeted tuning of this process.
The literature shows that these AT repeats can increase or decrease stepwise, can occur relatively frequently in introns, and can change their length up to ten thousand times faster than usual mutations. They are always larger than one and never reach excess length. The mechanism by which a STR affects protein remains unclear. The most frequently mentioned is that the role of non-coding STRs is in regulating gene expression. It is the richest source of genotypic variation.
Experimental:
You have the string from the second intron of R2R3-MYB2 of Diplacus parviflora
AAGTCCTCTCTCTCTCTCTCTCTTTCTCTCTCTAAAACTCTATCTGCCTAAAACTCTATCTGCCTGTCTATATATCTCGTTAAATGATATATAGACAGGCAGATAGAGTTTTAGGTACC
1) copy it and go to :
What can you conclude? Be aware it's a non-coding region.
In a further attempt, how many steps might one need to make out of a non-functional whole 2R3RMYB2 genomic reading of any yellow-flowering Diplacus plant a functional one?