Studies on Transition 
 in -  Diplacus  - PLANTS
 

PENSTEMON DRAFT 

It is fantastic: on the one hand, we have old distribution literature on Penstemon dating back to the 1950s. On the other hand, we have the latest tools to identify genomic information across numerous species. We aim to elucidate the differences between Penstemon species with no anthocyanin in their flowers and those with active anthocyanin production in the petals. This way, we can jump off to some beautiful molecular mechanisms.


We begin by illustrating the ROS1-like transcription factor in Penstemon smallii. This MYB is responsible for the blue and red coloration of the Penstemon petals. The T-chain and A-chain inserts within both introns may encode regulatory sequences that directly influence the MYB factor. Chromosome 8: 33,605,966-33,608,500   ACJIZ3-014592 ≈ MYB transcription factor Solanum lycopersicum



On chromosome 2, an R2R3MYB factor similar to "ROS2" is found. Notably, there is a reverse hairpin within the first intron (double-fleshed arrow).

(In Genome DATA Viewer search assembly: ACJIZ3_002330)

An EL-like ortholog, R2R3MYB, is found on Chromosome 8. A very long TATA hairpin manifests in intron 2. (Zoom to pos. 33,426,136 to see the long TATA string.)




Another R2R3-MYB factor in the proof is responsible for anthocyanin-colored petal veins in Penstemon. The long "dirty" T-string within the first intron may influence the activity of the holding gene.

 

If we blast the whole ROS1 sequence against SRX24397021 from "Penstemon eatonii", we see rather uniform strings with the exception that the STRpoly A does vary slightly in its length. This is a normal phenomenon and is accounted for by quantum mechanics. Because the variation is low, this indicates that the living system is in equilibrium with respect to the regulating aspect of polyA. The length of this polyA string, which is an enhancer spot, points to the high activity of the transcription factor in the floral tissue of the petals. In contrast, the string of P. digitalis {agcaaaaaaaataaaaaaag} has a much shorter sequence infiltred by T, which suggests a less active or non-active transcription factor regulating anthocyanin in floral petals. In fact, the flower of P. digitalis is white. 




...