Intron Code: PUSMI-PULLU-CODE (DRAFT)

In the so far non-coding Introns of numerous regulating proteins of Diplacus, one may find Short Tandem Repeats like:

One can also find stem-loop-stem hairpins;

 All these structures affect the regulation of the hosting genes. They can appear and disappear during a plant's lifetime in somatic cells. Some build extended hairpins, especially in upregulated genes.

We call the whole variety of STRs:  Pushmi-Pullu-Code.

some examples:

Immune response protein  >>  TTTTTTTTTTAAAAAAAAA

Zinc-Ion-protein >>  TATATATATATATAT ... 

Endoplasmatic reticulum membrane protein  >> TATACACATATAGAGA

Pyruvate dehydrogenase protein  >> CCCCCCTCTCTCTC ...

 

 

MAUR_00549 is a MYB5 that resembles the R2R3MYB2 anthocyanin transcription factor. Notably, this TATA-String is bordered by CCAA sequences on both ends.

CCCCAAAATATATATATATACCCCCAAAAA

 

The sequences were published in 2009, although the real reason for the different gene activity at that time was not really entailed. It seems obvious to us; it is most probably the TATA-STR, which can be considerably long in red-flowered individuals and very short in the yellows. One should also check the promoter.

However, the DFR enzyme also has a more or less long GAGA repeat in one intron. This length may influence the number of molecules produced.

 

CCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCT